Next Article in Journal
Diabetes Patients’ Acceptance of Injectable Treatment, a Scientometric Analysis
Next Article in Special Issue
Diagnostic Accuracy of an Indirect Enzyme Linked Immunosorbent Assay (iELISA) for Screening of Babesia bovis in Cattle from West Africa
Previous Article in Journal
Role of Intra-Parotid Lymph Node Metastasis in Primary Parotid Carcinoma
Previous Article in Special Issue
Immune Cell Reaction Associated with Coenurus cerebralis Infection in Sheep with Particular Reference to ELISA as a Diagnostic Tool
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Life
Volume 12
Issue 12
10.3390/life12122054
life-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

The Biological Activity of Illicium verum (Star Anise) on Lernaea cyprinacea-Infested Carassius auratus (Goldfish): In Vivo Study

by
Marwa M. Attia
1,
Amal M. Alzahrani
2,
Magdy I. Hanna
3,
Heba M. Salem
4,
Mohammed A. S. Abourehab
5,
Mohamed T. El-Saadony
6,* and
Hasnaa Thabit
7
1
Department of Parasitology, Faculty of Veterinary Medicine, Cairo University, Giza 12211, Egypt
2
Department of Biology, Faculty of Arts and Science in Almandaq, Al Baha University, Al Baha 65799, Saudi Arabia
3
Department of Aquatic Animal Medicine and Management, Faculty of Veterinary Medicine, Cairo University, Giza 12211, Egypt
4
Department of Poultry Diseases, Faculty of Veterinary Medicine, Cairo University, Giza 12211, Egypt
5
Department of Pharmaceutics, College of Pharmacy, Umm Al-Qura University, Makkah 21955, Saudi Arabia
6
Department of Agricultural Microbiology, Faculty of Agriculture, Zagazig University, Zagazig 44511, Egypt
7
Department of Zoology and Entomology, Faculty of Science, Assiut University, Assiut 71515, Egypt
*
Author to whom correspondence should be addressed.
Life 2022, 12(12), 2054; https://doi.org/10.3390/life12122054
Submission received: 10 October 2022 / Revised: 22 November 2022 / Accepted: 25 November 2022 / Published: 7 December 2022
(This article belongs to the Special Issue Advances in Livestock and Human Parasites)
Browse Figures
Versions Notes

Abstract

:
Lernaea cyprinacea infestation is considered a serious economic problem in the fish market. An assessment to control this parasite is needed to manage this problem. The Illicium verum oil extract has considerable antioxidant activity and scavenges 96.22% of free radicals; the high antioxidant activity refers to the phenolic content presence. The extract contains minerals, especially K, fibers, and dry matter. So, the Illicium verum ingredients were tested against this copepod for in vitro and in vivo investigation with the assessment of the treatment trial using a scanning electron microscope and evaluating the change in different immunological genes in goldfish. Female parasitic L. cyprinacea worms were blackish and hairy. The in vitro study on L. cyprinacea adults using star anise revealed that the LC50 was 12.5 and 25 μg/mL for 2 and 1 h exposure periods, respectively. Interleukin (IL-1β) and IL-6 were grossly upregulated in C. auratus-infested skin by L. cyprinacea after treatment by 1 week, then declined after 3 weeks. In contrast, TNF-α was 18 folds upregulated in the first week after treatment, with a decline after 3 weeks. In conclusion, star anise is recommended as a safe and economical agent for controlling L. cyprinacea infestation in fish.

1. Introduction

Lernaea cyprinacea, popular as the anchor worm, is a lernaeid copepod. The most dangerous parasite can infect freshwater fish, particularly juvenile ones [1,2]. The adult parasite enters the body, then becomes deeply implanted in the tissues of the fish host [3]. With global distribution, this species (spp.) is considered a serious invasive external parasite on fish. Lernaea cyprinacea is widely spread in freshwater crustaceans and is accompanied by different water hosts such as tadpoles and fish [4,5].
The Cyprinidae family is the most susceptible fish family, involving common carp, goldfish, and koi [6]. Only adult female worms infect the fish fins, gills, integument, eyes, nostrils, and oral cavity, but the preferable site is the base of the fins and abdominal region [7]. Their mouths and two pairs of anchors are inserted into the host muscles, and they have an extended thready body with two trailing egg sacs.
Although mass fish deaths from L. cyprinacea infestations are rare, repeated infestations and prolonged contact can reduce fish development and productivity and negatively damage their looks and health [8,9]. Individual parasites can produce hemorrhagic and ulcerated lesions and severe localized damage to the affected tissue. Secondary bacterial and fungal infections probably occur because these lesions can lead to death [1]. The mechanical disconnecting of the female parasite on a large scale is problematic since the removal procedure is often partial, leaving the anchor within the fish cells.
The most-often employed insecticides against L. cyprinacea are potassium permanganate and organophosphate pesticides. However, they typically influence the stages of the parasites that survive on the host more than adult worms, and safety measures versus potential fish toxicity must be taken [1]. To guarantee that many chemical therapy protocols destroy all parasitic stages against this copepod, the recommended dose for chemotherapeutic agents is once a week, repeated four times [1].
Lernaea cyprinacea copepods may be easily destroyed by bathing in organophosphate solutions [10,11,12]. Usually, organophosphate or synthetic pyrethroid solutions are used to get rid of ectoparasites [10]. Medicinal herbs and their derivatives are increasingly used in aquaculture worldwide because they are biodegradable, easy to find and grow, and do not build up in animal tissues [13].
Various materials were used as phyto-therapeutic agents in sustainable aquaculture to overcome parasitic copepod infestations [14]. Terpenes, terpenoids, phenyl-propenes, and isothiocyanates are the main active groups in EOs that are considered a potent biocidal for bacteria and parasites. EOs are made up of various chemicals that do not have a unique cellular target in parasites [15]. The essential oils’ (EOs)—monoterpenes-pinene and sabinene—have been shown to have antiparasitic action. Furthermore, the synergistic impacts of multiple mixtures in EOs are another important property demonstrating a greater mode of action than single drugs. Because EOs are hydrophobic and can get into cells, potassium ions and cytoplasmic components leak out of parasitic cells, altering the cells’ shape and stopping the parasites from completing their job [16].
Ding et al. [17,18] and Patra et al. [19] found that anethole was the main compound in star anise (85–90%), followed by estragole, and anisaldehyde. It is worth noting that star anise and its extracts have a lot of the aromatic plant’s flavor [20]. However, this strategy has not been used due to negative experiences with pesticide toxicity. It is unclear whether Illicium verum has biocidal properties against L. cyprinacea. A novel strategy to overcome L. cyprinacea utilizing this plant extract was tested. Before and after treatment, different cytokines released during the infection were studied using a scanning electron microscope (SEM) and immunological assessment. Lastly, the antiparasitic effects of Illicium verum on L. cyprinacea were examined, both in a test tube and a living animal.

2. Materials and Methods

2.1. Fish Inspection and Samples’ Collection

Anchor worms that had infested a local goldfish merchant in Egypt’s Giza governorate in September 2021 were collected. The history, manifestations, incidence, and intensity of the illness were all reported during the investigation. One hundred and twenty contaminated adult Goldfish (Carassius auratus) were caught and delivered to the Faculty of Veterinary Medicine, Cairo University’s parasitology lab, in a 50-L tank, accompanied by aeration. The goldfish ranged from 9–15 cm in length and from 80–120 gm in weight. Adult and surviving copepods were picked up by a mechanical method from the fish, identified, and described in the lab [21]. All institutional guidelines for the animals’ care and handling were considered. The Ethical Committee approved this study of animal use and their care under registration number: 17300826.

2.2. Collection of the Plant Extract

Illicium verum L. (Figure 1) was dried and powdered in an oven at 40 °C. Maceration with 250 mL of methanol or dichloromethane for three hours at room temperature with shaking was used to extract the dried powdered material (50 g). Through the use of hydro-distillation, anise oil was extracted and filtered. Then, 100 g of dried star anise fruit were crushed into bits and extracted with 800 mL of deionized water in a round bottom flask with a Clevenger-style setup under 70 °C for 24 h, as reported by Politeo et al. [22]. Filtering was executed on the extracts. Then, the majority of the water was removed. The addition of anhydrous MgSO4 dried the extracts from anise oil. The suspension was produced as pure anise oil after settling [19,23].

2.3. Chemical Composition of Illicium verum Extract

The oil extract of Illicium verum was dissolved in Dimethyl sulfoxide (DMSO) for the following examination. Moisture was determined by drying in an air oven at 110 °C until constant weight; crude protein was evaluated using the Micro-Kjeldahl method to determine the total nitrogen and multiplying its value by 6.25. The oil content was evaluated in a Soxhlet apparatus using n-hexane (40–60 °C) as a solvent; ash content was determined by ashing in an electric muffle at 550 °C until a constant weight. The crude fiber content was calculated using the technique described [24]. All determinations were made using the indicated procedures [25]. Carbohydrates were determined using the difference technique (=100 − (% protein + % fat + % ash + % fiber) [26]. The wet ashing technique was used to assess mineral concentrations [25]. Na, K, Mn, Co, Zn, Fe, Cu, Ni, and P were assessed at the Central Laboratory, Kafeel Sheikh University, utilizing the atomic absorption (NC.9423-400-30042) England method, as outlined by AOAC [25].
Singleton et al. [27] measured the total soluble phenolics of the DMSO fraction using the Folin–Ciocalteu reagent and gallic acid as the standard phenolic compound [28]. In separate test tubes, 40 µL of DMSO fraction and standard were transferred, and 200 µL of diluted Folin–Ciocalteu reagent was added. The mixture was stirred thoroughly, left for eight minutes, and then added to 600 µL of sodium carbonate solution 7.5% while stirring continuously. A spectrophotometer measured the solution’s absorbance at 750 nm after incubation for one hour in the dark. Illicium verum oil extract’s total phenolic components were measured in mg of the gallic acid standard curve (G.A.E.) [29,30].
Kim et al. [31] evaluated the total flavonoid content of the DMSO fraction using catechin as a reference. A total of 1 mL of DMSO fraction (100 g/mL) was mixed with 4 mL of purified water and 300 µL of aluminum chloride. Five minutes were spent incubating the mixture at room temperature. At 510 nm, the absorbance of samples was measured. Regarding catechin equivalents (mg/g), the total flavonoid content of the DMSO fraction was expressed [32].
The chemical composition of star anise extract is presented in Table 1. The extract has considerable antioxidant activity and scavenges 96.22% of free radicals; the high antioxidant activity refers to the phenolic content presence. The extract contains minerals, especially K, fibers, and dry matter.

2.4. HPLC Phenolic Profiling of Star Anise Extract

The HPLC Shimadzu series (Shimadzu-prominence-20A, Tokyo; Japan) was utilized to identify the phenolic profile in the star anise extract. The mobile phase was 0.01% acetic acid in water (A) and acetonitrile. The stationary phase was a separation column (Gemini, C18) with a 2 mL/min flow rate (4.6 × 150 × 5 um) and a 2 mL/min flow rate (4.6 × 150 × 5 um) (B). Monitoring and controlling the HPLC pumps, autosampler, column, oven, and diode array system. Class VP software was used to analyze the chromatographic results (Shimadzu 5.0) [33,34,35]. The phenolic compounds were analyzed at 280 nm and the flavonoids at 370 nm.
Table 2 shows the phenolic profile of star anise extract by HPLC, where Vanillic (5704.35), Protocatechuic (6052.15), Coumarin (18,384.35), Chlorogenic (11,932.1), Iso ferulic (5592.05), Luteolin 7 glucose (5151.4), Apigenin 6-rhamnose 8-glucose (5333.2505), and Apigenin-7-0-neohes (15271 mg/L) were found in high content, while medium contents of Ferulic, (4071.41), P-OH benzoic, (2148.85), Caffeine, (4094.1), Catechol, (2501), Caffeic, (2711.5), Cinnamic, (4457.35), Benzoic, (4575.5), 4-amino benzoic acid, (4228.05), Salicylic, (4873.23), Naringin, (4424.44), Acacetin neo. rutinoside, (3802.675), Quercetin, (3753.705), and Quercitrin, (2427.615) were found in the star anise extract. These phenolics protect against the parasite and oxidative stresses [36].

2.5. Volatile Compounds in Star Anise Essential Oil by GC-Mass

For determination of the chemical composition of basil leaves, leaves of peppermint, and clove buds EOs, gas chromatography–mass spectrometry (GC-MS) analysis was conducted using GC-2010 Shimadzu capillary gas chromatography directly coupled to the mass spectrometer system (GC-MS–model QP 2010; (Shimadzu, Kyoto, Japan)) DB-c18 column under the following conditions: The injector temperature was 250 C. Oven temperature program: 30 °C for 2.0 min, then ramp to 250 °C at a rate of 2.0 degrees Celsius per minute for 5.0 min. The MS source temperature was 200 °C, electron energy was 70 eV, the carrier gas was helium at a flow rate of 1.4 mL/min, and 1 µL of each diluted sample in n-hexane (1:1, v/v) was injected. EI spectra were scanned from 43.00 to 600 m/z to identify peaks through NIST mass data-search libraries and the highest REV and similarity indicators’ hits. The sample components were identified by comparing their relative indices and mass spectra with the computer controlling the GC-MS system [37,38].
Table 3 shows the VOCs in star anise essential oil. The main compound in the essential oil is (E)-Anethole* accounted for 89.24% of oil, followed by lower contents. Volatile organic compounds exhibited powerful potential against parasites [39].

2.6. LC50 of Illicium verum on L. cyprinacea

Illicium verum was evaluated for testing the mortality of L. cyprinacea, which was diluted with phosphate-buffered saline, making two-fold serial dilutions of (25 μg/mL, 12.5 μg/mL, 6.25 μg/mL, 3 μg/mL, 2 μg/mL, 1 μg/mL) [40,41]. Commercial clove oils (Ectyo-clove®; Paris, France) were used to anesthetize L. cyprinacea-infested fish to remove the live female parasite manually. Two hundred adult surviving parasite females of L. cyprinacea were harvested and separated into 20 L. cyprinacea/dilution/replicate groups. The copepods were inspected using a light microscope after exposure to graded Illicium verum dilutions for 1, 2, 4 and 8-h periods, and the mortality rate was recorded [21].

2.7. Demonstration of the Effect of the Illicium verum on L. cyprinacea by SEM

Five parasite females of L. cyprinacea subjected to Illicium verum were harvested and rinsed multiple times with saline. The copepods were rinsed multiple times with saline, then cleaned in lactophenol and loaded on gelatin to analyze their morphology [21,42]. Five freshly obtained copepods were rinsed multiple times in saline. Adult L. cyprinacea was immersed in 2.5% glutaraldehyde. After that, the specimens were dehydrated in an increasing ethanol series, dried in a CO2 critical point drier (Autosamdri-815; Lewis Avenue, Rockville, ML, USA), bonded over stubs, and sputter-covered with twenty nm gold (Spi-Module sputter coater; UK). Then, the specimens were inspected and photographed using a scanning electron microscope (SEM) at magnifications ranging from 35 to 500 (JEOL JSM 5200 Electron Probe Microanalyzer; Tokyo, Japan) [21].

2.8. In Vivo Parasiticidal Efficacy of the Illicium verum

In glass aquariums of 20 cm × 30 cm × 40 cm, fifteen adult goldfish infected with adult L. cyprinacea were placed in 10 L of tap water after chlorine removal. They were kept in the lab for three days before being exposed. The fish were exposed to 12.5 μg/mL of Illicium verum for 2 h. The water was then drained and replenished with new water. The fish were checked for 14 days post-infection and were supplied with commercial fish pellet feed once per day at 1% body weight.

2.9. Evaluation of Biological Parameters

The skin was dissected from the fish infested with copepods and control non-infested fish groups (healthy fish) and the treated fish 1 and 3 weeks after exposure to star anise; all samples were kept aseptically at −20 °C for subsequent research.

2.10. Extraction of mRNA

According to the manufacturer’s instructions, a Total RNA kit (Ambion; Applied Biosystems) was used to extract mRNA from 100 mg of the integument. Using a FastPrep-24 homogenizer (MP Biomedicals; Bio Laboratories Pte Ltd Lobby A, Ubi Techpark, Singapore) 2 cycles of 30 s at 6 m/s, the fish’s skin was homogenized and placed in Lysing Matrix D tubes (MP Biomedicals). The quantity and purity of the RNA were determined by Nanodrop (Thermo Scientific, Waltham, MA, USA). According to the manufacturer’s recommendations, 500 ng of mRNA were obtained using DNaseI amplification grade (Invitrogen). The reverse transcription of treated RNA was achieved following the approach described by Tu et al. [43] and Younis et al. [44], and the High-Capacity cDNA Archive Kit (Applied Biosystems) was used. Table 4 lists the qRT-PCR primer sets specific for TNF-α, IL-1β, and IL-6 specific for Carassius auratus based on the sequences deposited in the GenBank; samples were obtained from 1 cm of skin and muscles infested with L. cyperinacea.
The approach described by Attia et al. [45,46,47] was followed for the extraction and synthesis of the analyzed mRNA. In a Step One™ Real-Time PCR System (Applied Biosystems, Bedford, MA, USA). 10 L of (SYBR® Premix Ex Taq TM (Tli RNase H Plus), ROX Plus (Takada 3-chome, Toshima-ku, Tokyo; Japan), 1 L of cDNA, and 0.5 L of the produced primer (100 nM) were mixed with 20 L of ultra-pure water.
The used cycling conditions were followed by Attia et al. [45]. The ∆CT value was determined by subtracting the controlled gene (β-actin), ∆ CT, as an internal control, from the result of the examined gene. Conditions for PCR cycling in a 40-cycle amplification, denaturation for 30 s at 94 °C, annealing for 30 s at 60 °C, and extension for 45 s at 72 °C were used for the 40-cycle amplification. Tu et al. [43] developed a real-time PCR technique. Three times the samples were taken.

2.11. Determination of Cytokines

TNF- (ng/mL), IL-1 (pg/mL), and MCP-1 (ng/mL) cytokine levels were measured in serum samples using the enzyme-linked immunosorbent assay (ELISA). The Human IL-1β Bioassay Technology Laboratory (BT-Lab; Shanghai, China) ELISA kit (Cat. No. E0143Hu), Human TNF-ELISA kit (Cat. No. E0082Hu), and Human MCP-1 ELISA kit (Cat. No. E0124Hu) ELISA procedures were followed. The ELISA procedure was carried out by adding 40 μL of a serum sample to the sample well. After that, it added 50 μL of streptavidin-HRP to the sample wells and standard wells. The wells were covered and incubated for 60 min at 37 °C, then washed with Wash Buffer five times. First, 50 μL of substrate solution, and then each well was attached, and 50 µL of substrate solution B was added. Next, it was incubated in the dark for 10 min at 37 °C. Following that, 50 µL of Stop Solution was added to each well. Within 10 min of adding the stop solution, each optical density (OD) value was correctly read with a microplate reader at a wavelength of 450 nm.

2.12. Total Protein Evaluation in Fish

Total protein was determined using Coomassie Brilliant Blue (G-250) [48]. Briefly, a solution of Coomassie Brilliant Blue dissolved in 95% ethanol was prepared at a final concentration of 20 mg/mL. Phosphoric acid (85%) was added in a ratio of 1:2, the mixture was stirred till the addition of water to a final concentration of (15%, v/v). The filtered solution was kept at 4 °C. A total of 100 mL fish filtrate sample was mixed with 5 mL Bradford reagent for 5 min. Bovine Serum Albumin was used to construct a standard curve for the quantification of total protein in samples (y = 0.0009x + 0.0148). The absorbance was measured at 595 nm [49].

2.13. Statistical Evaluation

SPSS version 21 was applied to analyze the mean of the triplicate data. Kirthi et al. [50] used probit analysis to determine the 50% mortality concentration with 95% confidence intervals. The LC50 was determined using the obtained regression equation (Y = mortality percent; X = log concentration) or by drawing a transverse line passing from probit 0.5 on the y-axis to the x-axis and determining the related log; concentration was then inversed to assess the LC50.

3. Results

Recurrent infections have been reported in adult goldfish and fingerlings, especially in the spring and autumn. Female parasitic L. cyprinacea seemed to be blackish hairy worms involved in focal locations on the host’s flanks, flank area, beneath the operculum, dorsal, and tail fins with the presence of ulcers around the attachment of the copepods (Figure 2).
The LC50 of Illicium verum on L. cyprinacea is recorded in Table 5. The recorded LC50 was 12.5 μg/mL for 2 h, and 25 μg/mL for a one-hour exposure period. SEM analysis of L. cyprinacea treated with Illicium verum revealed that the anchor was corrugated and shrinkage showing wrinkles, longitudinal folds, and a malformed body with a severely corrugated and reduced posterior end (Figure 3 and Figure 4).
The female L. cyprinacea had completely separated from the afflicted fish after 2–7 days of exposure to I. verum. The remaining lesions looked to have healed 7 days post-exposure. The treated fish appeared healthy during the monitoring period, with no signs of re-infestation. In the C. auratus skin infested by L. cyprinacea, IL-1β was 25-fold more upregulated than in the control non-infested fish. Concerning the expression of mRNA of the treated fish using star anise, IL-1β was 35-fold upregulated in the first week after treatment, then declined after 3 weeks to 15-fold more than in the control non-infested fish. All genes were expressed significantly higher than the control non-infested group (3.50 ± 0.00) (p = 0.0001) (Figure 5).
In the C. auratus skin infested by L. cyprinacea, IL-6 was 15-fold more upregulated than in the control non-infested fish. Concerning the expression of mRNA of the treated fish using star anise, IL-6 was 20-fold upregulated in the first week after treatment, then declined after 3 weeks of treatment to 10-fold more than in the control non-infested fish. All genes were expressed significantly higher than the control non-infested group (4.20 ± 0.00) (p = 0.0001) (Figure 6).
In the C. auratus skin infested by L. cyprinacea, TNF-α was 18-fold more upregulated than in the control non-infested fish. Concerning the expression of mRNA of the treated fish using star anise, TNF- α was 23-fold upregulated in the first week after treatment, then declined after 3 weeks of treatment to 12-fold more than in control non-infested fish. All genes were expressed significantly higher than the control non-infested group (3.50 ± 0.00) (p = 0.0001) (Figure 7).
At the level of protein expressed in fish after treatment with star anise extract, the total protein content decreased in infected fish, i.e., 0.9 mg/g as compared to the control 2.1 mg/g; after one-week treatment with star anise extract in the fish diet the total protein increased with a relative increase of 80 and 322% compared to control and infected fish; (Figure 8).

4. Discussion

Illicium verum (Magnoliaceae) is found throughout Asia’s tropical and subtropical zones. The fruits are widely available in the marketplaces. Star anise is a popular spice. The oil is used as a flavoring, and the spice is used for flavoring food [17]. Star anise oil has tonic, appetite stimulant, carminative, diuretic, and moderate expectorant properties [51]. It is a popular element in cough treatments and is useful for flatulence, spasmodic discomfort, and colic. Topically, the oil is used to treat rheumatism and otalgia and as an antibacterial [51].
Lernaeosis is a disease caused by copepod parasites of the genus Lernaea (Linnaeus, 1758) (Cyclopoida: Lernaeidae), which can infest a variety of freshwater fish spp., having major pathogenic consequences on their hosts [52,53]. L. cyprinacea causes critical issues in the marketing of ornamental fish. The current investigation detected a severe L. cyprinacea infection in a goldfish glass aquarium; the female worms were connected to the integument of the flank area and fin base, as these parts provide high defense versus the water currents [7,54].
They can cause bleeding and necrosis on the gills, resulting in a reduction in breathing capacity. The adult worm also infects the fish, attaching itself deeply in the cells and revealing lesions to the tegument, external muscular cell, eye, and, in some circumstances, even the internal systems. Young fishes are particularly vulnerable, as even a few parasites can kill them [55,56].
Different control measures of the disease include chemical, biological, plant, or natural control agents. Among them, the natural one is the best control. It is a new alternative method for sustainable aquaculture using EOs or other herbal items to combat microbial agents and parasitic illnesses [52,57].
In this study, star anise was evaluated for antiparasitic activity in vitro and in vivo against L. cyprinacea, with a good result in low concentration where the LC50 was 12.5 μg/mL for a 2 h exposure period; or for 25 μg/mL for 1 h exposure. This study uses direct contact and fumigation approaches such as the previous study on arthropods (Drosophila melanogaster) with mortality using star anise in vitro. The main component of the methanol extract was (E)-anethole. The 5-day LD50 of (E)-anethole in D. melanogaster was a diet containing 0.2 mg/mL [20,58]. In addition, the insecticidal effect of (E)-anethole was demonstrated versus adult Blattella germanica [40] at 0.159 mg/cm2 one and three days post-treatment. (E)-anethole induced an 80.3 percent mortality in a filter paper diffusion approach, whereas hydramethylnon (positive control) caused 93.3 percent mortality.
Essential oil from the fruit of I. verum was also found to have insecticidal activities against Callosobruchus chinensis, Botrytis cinerea, and Colletotrichum gloeosporioides larvae and adults [59,60,61]. I. verum oil had an LC50 of 12.5 and 11.1 μL against C. chinensis adults and larvae. The LC50 for T. castaneum adults and larvae was 19.87 and 18.43 μL, respectively. Maini and Morallo-Rejesus [62] investigated the toxicity of star anise oil to golden snails, finding that 10–20 ppm caused 100 % mortality in juvenile snails. Meanwhile the previous study of cat flea control using star anise was recorded by Freitas et al. [41], who recorded 100% mortality when using 400 μg.cm2 after a 48-h exposure period.
Our results revealed that the proinflammatory cytokines (IL-1β, IL-6, and TNF-α) were increased during the infestation with L. cyprinacea in goldfish; these findings are similar to those recorded by Tu et al. [43], which applied to goldfish infested with Gyrodactylus kobayashii and the cytokines were again elevated during treatment with the star anise. These results are supported by those recorded by Vaseeharan and Thaya [63]. They stated that essential oils are also immunostimulants. Zhang et al. [64] and Sarhadi et al. [65] stated that feeding Cyprinus carpio with Origanum vulgare and Artemisia annua for eight weeks improved both the immunological and antioxidant qualities, which increased IL-1β, as well as resistance to A. hydrophila. EOs boosted IL-1β and IL-10 transcription while decreasing TNF-α and transforming growth factor (TGF-β).
The interleukin-6 (IL-6) family of cytokines performs various biological functions and exhibits a high level of redundancy within the family. Although several mRNA transcripts from teleost fish resembling cytokines of the IL-6 family have been discovered, none have been functionally characterized to establish their identity. We describe the discovery and functional analysis of goldfish M17, a molecule with sequence and mRNA expression patterns resembling ciliary neurotrophic factor and mammalian leukemia inhibitory factor in mammals and birds.
Besides the beneficial uses of star anise in therapy for different diseases, there are several case reports relating to juveniles recording neurotoxicity and hepatotoxicity, such as those recorded in [66,67,68]. However, those investigations were in juveniles and employed homemade herbal remedies; though several investigations and extensive research were completed in relation to this plant to prove these case reports. In addition, this plant gave good results in relation to different parasites.
Essential oil-based biopesticides have a bright future [66,67,68]. EOs of star anise are highly effective, have multiple modes of action (suitable for usage versus insect resistance), and are low in toxicity involving people. Additionally, obtaining EOs is often simple and inexpensive, and the risk of intoxication is negligible [67].

5. Conclusions

In conclusion, for the first time, the anti-copepodal effect and residual value of the EOs of star anise were detected in this study. The pharmaceutical and agronomy industries are interested in developing biopesticides for veterinary and fisheries’ medication, since the star anise EOs are safe and environmentally friendly and can be used against parasites infesting aquatic organisms.

Author Contributions

M.M.A., A.M.A., M.I.H., H.M.S., M.T.E.-S. and H.T. shared in the samples’ collection; M.M.A., A.M.A., M.I.H. and M.T.E.-S. completed the statistical analysis; M.M.A., M.I.H., H.M.S., M.T.E.-S., and H.T. completed the parasitological examination and gene expression; A.M.A., and M.A.S.A. reviewed and edited the manuscript, and gained funding; M.M.A., M.I.H., H.M.S. and H.T. wrote the manuscript. All authors revised the manuscript and approved the final version. All authors have read and agreed to the published version of the manuscript.

Funding

This work was funded by Umm Al-Qura University with grant code (23UQU4290565DSR111).

Institutional Review Board Statement

This work was ethically approved by Institutional Review Board of the Faculty of Medicine, Assuit University, Assuit, Egypt with ethical number 17300826.

Informed Consent Statement

Not applicable.

Data Availability Statement

The data presented in this study are available on request from the corresponding authors.

Acknowledgments

The authors thank the Deanship of scientific research at Umm Al-Qura University for supporting this work by grant code (23UQU4290565DSR111).

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Goodwin, A.E. Massive Lernaea cyprinacea infestations damaging the gills of channel catfish polycultured with bighead carp. J. Aquat. Anim. Health 1999, 11, 406–408. [Google Scholar] [CrossRef]
  2. Hassan, M.; Beatty, S.; Morgan, D.; Doupé, R.; Lymbery, A. An introduced parasite, Lernaea cyprinacea L., found on native freshwater fishes in the south west of Western Australia. J. R. Soc. West. Aust. 2008, 91, 149–153. [Google Scholar]
  3. Avenant-Oldewage, A. 21 Lernaea cyprinacea and related species. In Fish Diseases: Pathobiology and Protection; Patrick, T., Woo, K., Buchmann, K., Eds.; CABI: Wallingford, UK, 2012; 337p. [Google Scholar]
  4. Koyun, M.; Ulupinar, M.; Mart, A. First Record of Lernaea cyprinacea L. 1758 (Copepoda: Cyclopoida) on Cyprinion macrostomus Heckel, 1843 from Eastern Anatolia, Turkey. Biharean Biol. 2015, 9, 44–46. [Google Scholar]
  5. Piasecki, W.; Goodwin, A.E.; Eiras, J.C.; Nowak, B.F. Importance of Copepoda in freshwater aquaculture. Zool. Stud. 2004, 43, 193–205. [Google Scholar]
  6. Raissy, M.; Sohrabi, H.; Rashedi, M.; Ansari, M. Investigation of a parasitic outbreak of Lernaea cyprinacea Linnaeus (Crustacea: Copepoda) in cyprinid fish from choghakhor lagoon. Afr. Zool. 2013, 12, 680–688. [Google Scholar]
  7. Abbas, F.; Ashraf, M.; Hafeez-ur-Rehman, M.; Iqbal, K.J.; Abbas, S.; Javid, A. Lernaea susceptibility, infestation and its treatment in indigenous major and exotic Chinese carps under polyculture system. Pak. J. Zool. 2014, 46, 1215–1222. [Google Scholar]
  8. Hossain, M.; Rahman, M.; Islam, M.; Alam, M.; Rahman, H. Lernaea (anchor worm) investigations in fish. Int. J. Anim. Fish Sci. 2013, 1, 12–19. [Google Scholar]
  9. Singh, R.; Raghavendra, A.; Sridhar, N.; Raghunath, M.; Eknath, A. Comparative susceptibility of carp fingerlings to Lernaea cyprinacea infection. Vet. Parasitol. 2011, 178, 156–162. [Google Scholar]
  10. Cruz-Lacierda, E.R.; De la Peña, L.; Lumanlan-Mayo, S. The use of chemicals in aquaculture in the Philippines. In Use of Chemicals in Aquaculture in Asia, Proceedings of the Meeting on the Use of Chemicals in Aquaculture in Asia, Tigbauan, Iloilo, Philippines, 20–22 May 1996; Aquaculture Department, Southeast Asian Fisheries Development Center: Iloilo, Philippines, 2000; pp. 155–184. [Google Scholar]
  11. Idris, H.; Amba, M. A note on Lernaea cyprinacea parasitizing the cultured marble goby Oxyeleotris marmorata and their control with salinity modification. Adv. Environ. Biol. 2011, 5, 817–820. [Google Scholar]
  12. Abumelha, H.M.; Alkhatib, F.; Alzahrani, S.; Abualnaja, M.; Alsaigh, S.; Alfaifi, M.Y.; Althagafi, I.; El-Metwaly, N. Synthesis and characterization for pharmaceutical models from Co (II), Ni (II) and Cu (II)-thiophene complexes; apoptosis, various theoretical studies and pharmacophore modeling. J. Mol. Liq. 2021, 328, 115483. [Google Scholar] [CrossRef]
  13. Abou-Kassem, D.E.; Mahrose, K.M.; El-Samahy, R.A.; Shafi, M.E.; El-Saadony, M.T.; El-Hack, M.E.A.; Emam, M.; El-Sharnouby, M.; Taha, A.E.; Ashour, E.A. Influences of dietary herbal blend and feed restriction on growth, carcass characteristics and gut microbiota of growing rabbits. Ital. J. Anim. Sci. 2021, 20, 896–910. [Google Scholar] [CrossRef]
  14. Tóro, R.M.; Gessner, A.d.A.; Furtado, N.A.; Ceccarelli, P.S.; de Albuquerque, S.; Bastos, J.K. Activity of the Pinus elliottii resin compounds against Lernaea cyprinacea in vitro. Vet. Parasitol. 2003, 118, 143–149. [Google Scholar] [CrossRef] [PubMed]
  15. Abd El-Hack, M.E.; El-Saadony, M.T.; Saad, A.M.; Salem, H.M.; Ashry, N.M.; Ghanima, M.M.A.; Shukry, M.; Swelum, A.A.; Taha, A.E.; El-Tahan, A.M. Essential oils and their nanoemulsions as green alternatives to antibiotics in poultry nutrition: A comprehensive review. Poult. Sci. 2021, 101, 101584. [Google Scholar] [CrossRef]
  16. Reda, F.M.; El-Saadony, M.T.; El-Rayes, T.K.; Farahat, M.; Attia, G.; Alagawany, M. Dietary effect of licorice (Glycyrrhiza glabra) on quail performance, carcass, blood metabolites and intestinal microbiota. Poult. Sci. 2021, 100, 101266. [Google Scholar] [CrossRef] [PubMed]
  17. Ding, X.; Yang, C.; Wang, P.; Yang, Z.; Ren, X. Effects of star anise (Illicium verum Hook. f) and its extractions on carcass traits, relative organ weight, intestinal development, and meat quality of broiler chickens. Poult. Sci. 2020, 99, 5673–5680. [Google Scholar] [CrossRef] [PubMed]
  18. Ding, X.; Yang, C.; Yang, Z. Effects of star anise (Illicium verum Hook. f.), essential oil, and leavings on growth performance, serum, and liver antioxidant status of broiler chickens. J. Appl. Poult. Res. 2017, 26, 459–466. [Google Scholar] [CrossRef]
  19. Patra, J.K.; Das, G.; Bose, S.; Banerjee, S.; Vishnuprasad, C.N.; del Pilar Rodriguez-Torres, M.; Shin, H.S. Star anise (Illicium verum): Chemical compounds, antiviral properties, and clinical relevance. Phytother. Res. 2020, 34, 1248–1267. [Google Scholar] [CrossRef]
  20. Wang, G.-W.; Hu, W.-T.; Huang, B.-K.; Qin, L.-P. Illicium verum: A review on its botany, traditional use, chemistry and pharmacology. J. Ethnopharmacol. 2011, 136, 10–20. [Google Scholar] [CrossRef] [PubMed]
  21. Abu-Elala, N.M.; Attia, M.M.; Abd-Elsalam, R.M. Chitosan-silver nanocomposites in goldfish aquaria: A new perspective in Lernaea cyprinacea control. Int. J. Biol. Macromol. 2018, 111, 614–622. [Google Scholar] [CrossRef]
  22. Politeo, O.; Jukić, M.; Miloš, M. Chemical composition and antioxidant activity of essential oils of twelve spice plants. Croat. Chem. Acta 2006, 79, 545–552. [Google Scholar]
  23. Li, H.; Wu, X.; Li, X.; Cao, X.; Li, Y.; Cao, H.; Men, Y. Multistage extraction of star anise and black pepper derivatives for antibacterial, antioxidant, and anticancer activity. Front. Chem. 2021, 9, 660138. [Google Scholar] [CrossRef] [PubMed]
  24. Obaid, R.J. Synthesis and biological evaluation of some new imidazo[1,2-c]pyrimido [5,4-e]pyrimidin-5-amine derivatives. J. Umm Al Qura Uni. Appl. Sci. 2021, 7, 16–22. [Google Scholar]
  25. AOAC. Official Methods of Analysis of AOAC International, 19th ed.; AOAC54 International: Gaithersburg, MA, USA, 2012. [Google Scholar]
  26. Singh, G.; Kapoor, I.; Panday, S.K. Studies on Essential Oils Part 7 Natural Sprout Inhibitors for Potatoes. Pestic. Res. J. 1997, 9, 121–124. [Google Scholar]
  27. Singleton, V.L. Lamuela-Raventos: Analysis of total phenoles and other oxidation substartes and antioxidants by means of folin-ciocalteu reagent. Methods Enzymol. 1999, 299, 152. [Google Scholar]
  28. El-Beeh, M.E.; El-Badawi, A.A.; Amin, A.H.; Qari, S.H.; Ramadan, M.F.; Filfilan, W.M.; El-Sayyad, H.I. Anti-aging trait of whey protein against brain damage of senile rats. J.Umm Al Qura Univ. Appl.Sci. 2022, 1–13. [Google Scholar] [CrossRef]
  29. Merrill, A.L.; Watt, B.K. Energy Value of Foods: Basis and Derivation; Human Nutrition Research Branch, Agricultural Research Service, US: San Francisco, CA, USA, 1955. [Google Scholar]
  30. Al Bratty, M.; Makeen, H.A.; Alhazmi, H.A.; Syame, S.M.; Abdalla, A.N.; Homeida, H.E.; Sultana, S.; Ahsan, W.; Khalid, A. Phytochemical, cytotoxic, and antimicrobial evaluation of the fruits of miswak plant, Salvadora persica L. J. Chem. 2020, 2020, 4521951. [Google Scholar] [CrossRef]
  31. Kim, D.-O.; Chun, O.K.; Kim, Y.J.; Moon, H.-Y.; Lee, C.Y. Quantification of polyphenolics and their antioxidant capacity in fresh plums. J. Agric.Food Chem. 2003, 51, 6509–6515. [Google Scholar] [CrossRef]
  32. Kirk, S.; Sawyer, R. Pearson’s Composition and Analysis of Foods; Longman Group Ltd.: London, UK, 1991. [Google Scholar]
  33. Hassanin, A.A.; Saad, A.M.; Bardisi, E.A.; Salama, A.; Sitohy, M.Z. Transfer of anthocyanin accumulating delila and rosea1 genes from the transgenic tomato micro-tom cultivar to moneymaker cultivar by conventional breeding. J. Agric. Food Chem. 2020, 68, 10741–10749. [Google Scholar] [CrossRef]
  34. Saad, A.M.; Sitohy, M.Z.; Ahmed, A.I.; Rabie, N.A.; Amin, S.A.; Aboelenin, S.M.; Soliman, M.; El-Saadony, M.T. Biochemical and functional characterization of kidney bean protein alcalase-hydrolysates and their preservative action on stored chicken meat. Molecules 2021, 26, 4690. [Google Scholar] [CrossRef]
  35. Abu-Dief, A.M.; El-Metwaly, N.M.; Alzahrani, S.O.; Alkhatib, F.; Abumelha, H.M.; El-Dabea, T.; Ali El-Remaily, M.A.E.A.A. Structural, conformational and therapeutic studies on new thiazole complexes: Drug-likeness and MOE-simulation assessments. Res. Chem. Int. 2021, 47, 1979–2002. [Google Scholar] [CrossRef]
  36. Rahman, M.M.; Rahaman, M.S.; Islam, M.R.; Rahman, F.; Mithi, F.M.; Alqahtani, T.; Almikhlafi, M.A.; Alghamdi, S.Q.; Alruwaili, A.S.; Hossain, M.S. Role of phenolic compounds in human disease: Current knowledge and future prospects. Molecules 2021, 27, 233. [Google Scholar] [CrossRef] [PubMed]
  37. Elshafie, H.S.; Racioppi, R.; Bufo, S.A.; Camele, I. In vitro study of biological activity of four strains of Burkholderia gladioli pv. agaricicola and identification of their bioactive metabolites using GC–MS. Saudi J. Biol. Sci. 2017, 24, 295–301. [Google Scholar] [CrossRef] [PubMed]
  38. Abu-Rayyan, A.; Al Jahdaly, B.A.; AlSalem, H.S.; Alhadhrami, N.A.; Hajri, A.K.; Bukhari, A.A.H.; Waly, M.M.; Salem, A.M. A Study of the Synthesis and Characterization of New Acrylamide Derivatives for Use as Corrosion Inhibitors in Nitric Acid Solutions of Copper. Nanomaterials 2022, 12, 3685. [Google Scholar] [CrossRef] [PubMed]
  39. Bouyahya, A.; Assemian, I.C.C.; Mouzount, H.; Bourais, I.; Et-Touys, A.; Fellah, H.; Benjouad, A.; Dakka, N.; Bakri, Y. Could volatile compounds from leaves and fruits of Pistacia lentiscus constitute a novel source of anticancer, antioxidant, antiparasitic and antibacterial drugs? Ind. Crops Prod. 2019, 128, 62–69. [Google Scholar] [CrossRef]
  40. Chang, K.S.; Ahn, Y.J. Fumigant activity of (E)-anethole identified in Illicium verum fruit against Blattella germanica. Pest Manag. Sci. 2002, 58, 161–166. [Google Scholar] [CrossRef] [PubMed]
  41. Freitas, J.P.; de Jesus, I.L.R.; Chaves, J.K.d.O.; Gijsen, I.S.; Campos, D.R.; Baptista, D.P.; Ferreira, T.P.; Alves, M.C.C.; Coumendouros, K.; Cid, Y.P. Efficacy and residual effect of Illicium verum (star anise) and Pelargonium graveolens (rose geranium) essential oil on cat fleas Ctenocephalides felis felis. Rev. Bras. Parasitol. Vet. 2021, 30, e009321. [Google Scholar] [CrossRef]
  42. Pallavi, B.; Shankar, K.; Abhiman, P.; Ahmed, I. Molecular identification of the fish parasite Lernaea. Indian J. Fish 2017, 64, 76–82. [Google Scholar] [CrossRef] [Green Version]
  43. Tu, X.; Qi, X.; Huang, A.; Ling, F.; Wang, G. Cytokine gene expression profiles in goldfish (Carassius auratus) during Gyrodactylus kobayashii infection. Fish Shellfish Immunol. 2019, 86, 116–124. [Google Scholar] [CrossRef]
  44. Younis, N.A.; Laban, S.E.; Al-Mokaddem, A.K.; Attia, M.M. Immunological status and histopathological appraisal of farmed Oreochromis niloticus exposed to parasitic infections and heavy metal toxicity. Aquac. Int. 2020, 28, 2247–2262. [Google Scholar] [CrossRef]
  45. Attia, M.M.; Abdelsalam, M.; Korany, R.; Mahdy, O.A. Characterization of digenetic trematodes infecting African catfish (Clarias gariepinus) based on integrated morphological, molecular, histopathological, and immunological examination. Parasitol. Res. 2021, 120, 3149–3162. [Google Scholar] [CrossRef]
  46. Attia, M.M.; Elgendy, M.Y.; Abdelsalam, M.; Hassan, A.; Prince, A.; Salaeh, N.M.; Younis, N.A. Morpho-molecular identification of Heterophyes heterophyes encysted metacercariae and its immunological and histopathological effects on farmed Mugil cephalus in Egypt. Aquac. Int. 2021, 29, 1393–1407. [Google Scholar] [CrossRef]
  47. Attia, M.M.; Elgendy, M.Y.; Prince, A.; El-Adawy, M.M.; Abdelsalam, M. Morphomolecular identification of two trichodinid coinfections (Ciliophora: Trichodinidae) and their immunological impacts on farmed Nile Tilapia. Aquac. Res. 2021, 52, 4425–4433. [Google Scholar] [CrossRef]
  48. Bradford, N. A rapid and sensitive method for the quantitation microgram quantities of a protein isolated from red cell membranes. Anal. Biochem. 1976, 72, e254. [Google Scholar] [CrossRef]
  49. Wojciechowska, M.; Stepnowski, P.; Gołębiowski, M. Identification and quantitative analysis of lipids and other organic compounds contained in eggs of Colorado potato beetle (Leptinotarsa decemlineata). J. Plant Dis. Prot. 2019, 126, 379–384. [Google Scholar] [CrossRef] [Green Version]
  50. Kirthi, A.V.; Rahuman, A.A.; Rajakumar, G.; Marimuthu, S.; Santhoshkumar, T.; Jayaseelan, C.; Velayutham, K. Acaricidal, pediculocidal and larvicidal activity of synthesized ZnO nanoparticles using wet chemical route against blood feeding parasites. Parasitol. Res. 2011, 109, 461–472. [Google Scholar] [CrossRef]
  51. Verghese, J. The world of spices and herbs. Spice India 1988, 11, 15–18. [Google Scholar]
  52. Furtado, W.E.; Cardoso, L.; de Medeiros, P.B.; Lehmann, N.B.; de Aguiar, E.B.; da Costa, N.M.; Bertoldi, F.C.; Martins, M.L. Antiparasitic potential of alternative treatments against larval stages of Lernaea cyprinacea. J. Parasit. Dis. 2021, 45, 1096–1105. [Google Scholar] [CrossRef]
  53. Valladao, G.M.R.; Gallani, S.U.; De Padua, S.B.; LATERÇA, M.; Pilarski, F. Trichodina heterodentata (Ciliophora) infestation on Prochilodus lineatus larvae: A host–parasite relationship study. Parasitology 2014, 141, 662–669. [Google Scholar] [CrossRef]
  54. Medeiros, E.S.; Maltchik, L. The effects of hydrological disturbance on the intensity of infestation of Lernaea cyprinacea in an intermittent stream fish community. J. Arid Environ. 1999, 43, 351–356. [Google Scholar] [CrossRef]
  55. El-Shall, N.A.; El-Hack, M.E.A.; Albaqami, N.M.; Khafaga, A.F.; Taha, A.E.; Swelum, A.A.; El-Saadony, M.T.; Salem, H.M.; El-Tahan, A.M.; AbuQamar, S.F.; et al. Phytochemical control of poultry coccidiosis: A review. Poult. Sci. 2022, 101, 101542. [Google Scholar] [CrossRef]
  56. Kabata, Z. Parasites and Diseases of Fish Cultured in the Tropics; Taylor & Francis Ltd.: Abingdon, UK, 1985. [Google Scholar]
  57. Tavares-Dias, M.; Martins, M.L. An overall estimation of losses caused by diseases in the Brazilian fish farms. J. J. Parasit. Dis. 2017, 41, 913–918. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  58. Miyazawa, M.; Ota, H.; Ishikawa, Y.; Kameoka, H. An Insecticidal compound from Illicium Verum. ChemInform 1993, 24, 44. [Google Scholar]
  59. Chaubey, M.K. Fumigant toxicity of essential oils from some common spices against pulse beetle, Callosobruchus chinensis (Coleoptera: Bruchidae). J. Oleo Sci. 2008, 57, 171–179. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  60. Lee, S.-O.; Park, I.-K.; Choi, G.-J.; Lim, H.-K.; Jang, K.-S.; Cho, K.-Y.; Shin, S.-C.; Kim, J.-C. Fumigant activity of essential oils and components of Illicium verum and Schizonepeta tenuifolia against Botrytis cinerea and Colletotrichum gloeosporioides. J. Microbiol. Biotechnol. 2007, 17, 1568–1572. [Google Scholar] [PubMed]
  61. Shukla, J.; Tripathi, S.; Chaubey, M. Toxicity of Myristica fragrans and Illicium verum essential oils against flour beetle Tribolium castaneum Herbst (Coleoptera: Tenebrionidae). Elec. J. Env. Agricult. Food Chem. 2009, 8, 403–407. [Google Scholar]
  62. Maini, P.; Rejesus, B. Toxicity of some volatile oils against golden snail (Pomacea spp.). Philipp. J. Crop Sci. 1992, 17, 27. [Google Scholar]
  63. Abd El-Hack, M.E.; El-Saadony, M.T.; Shafi, M.E.; Alshahrani, O.A.; Saghir, S.A.; Al-Wajeeh, A.S.; Al-Shargi, O.Y.; Taha, A.E.; Mesalam, N.M.; Abdel-Moneim, A.M.E. Prebiotics can restrict Salmonella populations in poultry: A review. Anim. Biotechnol. 2021, 19, 1–10. [Google Scholar] [CrossRef]
  64. Zhang, R.; Wang, X.; Liu, L.; Cao, Y.; Zhu, H. Dietary oregano essential oil improved the immune response, activity of digestive enzymes, and intestinal microbiota of the koi carp, Cyprinus carpio. Aquaculture 2020, 518, 734781. [Google Scholar] [CrossRef]
  65. Sarhadi, I.; Alizadeh, E.; Ahmadifar, E.; Adineh, H.; Dawood, M.A. Skin mucosal, serum immunity and antioxidant capacity of common carp (Cyprinus carpio) fed artemisia (Artemisia annua). Ann. Anim. Sci. 2020, 20, 1011–1027. [Google Scholar] [CrossRef]
  66. Mossa, A. Green pesticides: Essential oils as biopesticides in insect-pest management. J. Environ. Sci. Technol. 2016, 9, 354–378. [Google Scholar] [CrossRef] [Green Version]
  67. Pavela, R.; Benelli, G. Essential oils as ecofriendly biopesticides? Challenges and constraints. Trends Plant Sci. 2016, 21, 1000–1007. [Google Scholar] [CrossRef] [PubMed]
  68. Raveau, R.; Fontaine, J.; Lounès-Hadj, S. Essential oils as potential alternative biocontrol products against plant pathogens and weeds: A Review. Foods 2020, 9, 365. [Google Scholar] [CrossRef] [PubMed]
Life 12 02054 g001 550
Figure 1. The star anise (Illicium verum) used in this study.
Figure 1. The star anise (Illicium verum) used in this study.
Life 12 02054 g001
Life 12 02054 g002 550
Figure 2. The infested goldfish with L. cyprinacea appear as hairs attached to the fins of the fish (A–D) (referred to with arrows). (A,B): Infested goldfish with L. cyprinacea on fins, referred to with an arrow; (C): The infestation with L. cyprinacea appeared as thread-like and was attached with forceps; (D): The site of the L. cyprinacea infestation was surrounded by an ulcer and hemorrhagic area, referred to with an arrow.
Figure 2. The infested goldfish with L. cyprinacea appear as hairs attached to the fins of the fish (A–D) (referred to with arrows). (A,B): Infested goldfish with L. cyprinacea on fins, referred to with an arrow; (C): The infestation with L. cyprinacea appeared as thread-like and was attached with forceps; (D): The site of the L. cyprinacea infestation was surrounded by an ulcer and hemorrhagic area, referred to with an arrow.
Life 12 02054 g002
Life 12 02054 g003 550
Figure 3. Scanning electron microscopic study of L. cyprinacea infesting goldfish aquaria after treatment with star anise (Illicium verum). (A,B): anchor of the copepod showing severe corrugation and shrinkage which referred by arrows. (C): posterior end of the copepod showing the destruction of the cuticle of the copepod; referred by arrows.
Figure 3. Scanning electron microscopic study of L. cyprinacea infesting goldfish aquaria after treatment with star anise (Illicium verum). (A,B): anchor of the copepod showing severe corrugation and shrinkage which referred by arrows. (C): posterior end of the copepod showing the destruction of the cuticle of the copepod; referred by arrows.
Life 12 02054 g003
Life 12 02054 g004 550
Figure 4. Light micrograph study of L. cyprinacea infesting goldfish aquaria after treatment with star anise (Illicium verum); showing destruction of the cuticle. (A): normal cuticle; (B): destructed cuticle with release of the eggs.
Figure 4. Light micrograph study of L. cyprinacea infesting goldfish aquaria after treatment with star anise (Illicium verum); showing destruction of the cuticle. (A): normal cuticle; (B): destructed cuticle with release of the eggs.
Life 12 02054 g004
Life 12 02054 g005 550
Figure 5. Gene expression analysis (IL-1β) of mRNA of goldfish infested with L. cyprinacea before and after treatment with Illicium verum (quantitative real time PCR analysis of immunological gene of interleukin1 β in goldfish before and after treatment trial). Different lowercase letters above columns indicates significant differences. Columns legend; Goldfish (control not infected or added Illicium verum), Goldfish Infested with L. cyprinacea, Goldfish treated with Illicium verum for 1 week, Goldfish treated with Illicium verum for 3 weeks.
Figure 5. Gene expression analysis (IL-1β) of mRNA of goldfish infested with L. cyprinacea before and after treatment with Illicium verum (quantitative real time PCR analysis of immunological gene of interleukin1 β in goldfish before and after treatment trial). Different lowercase letters above columns indicates significant differences. Columns legend; Goldfish (control not infected or added Illicium verum), Goldfish Infested with L. cyprinacea, Goldfish treated with Illicium verum for 1 week, Goldfish treated with Illicium verum for 3 weeks.
Life 12 02054 g005
Life 12 02054 g006 550
Figure 6. Gene expression analysis (IL-6) of mRNA of goldfish infested with L. cyprinacea before and after treatment with Illicium verum (quantitative real time PCR analysis of immunological gene of interleukin 6 in goldfish before and after treatment trial). Different lowercase letters above columns indicate significant differences. Columns legend; Goldfish (control not infected or added Illicium verum), Goldfish Infested with L. cyprinacea, Goldfish treated with Illicium verum for 1 week, Goldfish treated with Illicium verum for 3 weeks.
Figure 6. Gene expression analysis (IL-6) of mRNA of goldfish infested with L. cyprinacea before and after treatment with Illicium verum (quantitative real time PCR analysis of immunological gene of interleukin 6 in goldfish before and after treatment trial). Different lowercase letters above columns indicate significant differences. Columns legend; Goldfish (control not infected or added Illicium verum), Goldfish Infested with L. cyprinacea, Goldfish treated with Illicium verum for 1 week, Goldfish treated with Illicium verum for 3 weeks.
Life 12 02054 g006
Life 12 02054 g007 550
Figure 7. Gene expression analysis TNF-α of mRNA of goldfish infested with L. cyprinacea before and after treatment with Illicium verum (quantitative real time PCR analysis of immunological gene of TNF-α in goldfish before and after treatment trial). Different lowercase letters above columns indicate significant differences. Columns legend; Goldfish (control not infected or added Illicium verum), Goldfish Infested with L. cyprinacea, Goldfish treated with Illicium verum for 1 week, Goldfish treated with Illicium verum for 3 weeks.
Figure 7. Gene expression analysis TNF-α of mRNA of goldfish infested with L. cyprinacea before and after treatment with Illicium verum (quantitative real time PCR analysis of immunological gene of TNF-α in goldfish before and after treatment trial). Different lowercase letters above columns indicate significant differences. Columns legend; Goldfish (control not infected or added Illicium verum), Goldfish Infested with L. cyprinacea, Goldfish treated with Illicium verum for 1 week, Goldfish treated with Illicium verum for 3 weeks.
Life 12 02054 g007
Life 12 02054 g008 550
Figure 8. Total protein content in goldfish before and after treatment with Illicium verum. Different lowercase letters above columns indicate significant differences. Columns legend; Goldfish (control not infected or added Illicium verum), Goldfish Infested with L. cyprinacea, Goldfish treated with Illicium verum for 1 week, Goldfish treated with Illicium verum for 3 weeks.
Figure 8. Total protein content in goldfish before and after treatment with Illicium verum. Different lowercase letters above columns indicate significant differences. Columns legend; Goldfish (control not infected or added Illicium verum), Goldfish Infested with L. cyprinacea, Goldfish treated with Illicium verum for 1 week, Goldfish treated with Illicium verum for 3 weeks.
Life 12 02054 g008
Table
Table 1. Chemical composition of star anise (Illicium verum).
Table 1. Chemical composition of star anise (Illicium verum).
Chemical CompositionContent (mg/L)
Approximate analysis
Protein6.5 ± 0.1
Fat3.76 ± 0.2
Fiber28.12 ± 0.5
Carbohydrates59.33 ± 0.6
Ash4.08 ± 0.1
Dry matter86.65 ± 0.3
Antioxidant content
Total phenols (mg/L)33.36 ± 0.9
Total flavonoids (mg/L)15.66 ± 0.2
Antioxidant activity (%)96.22 ± 1.1
Minerals (mg/L)
Zn14.2 ± 0.2
Fe58.3 ± 0.1
Cu15.3 ± 0.3
Mn115.3 ± 1.3
CoND
NiND
P912.30 ± 1.8
K5651.96 ± 1.1
Na860.61 ± 0.9
Data are presented mean ± SD.
Table
Table 2. Phenolic compounds of star anise (mg/L).
Table 2. Phenolic compounds of star anise (mg/L).
Phenolic CompoundConcentration (mg/L)
Vanillic5704.35 ± 0.1
3.4.5. methoxy cinnamic1448.9 ± 0.9
Catechin2525.8 ± 0.5
Protocatechuic6052.15 ± 0.1
Ferulic4071.41 ± 0.6
Coumarin18,384.35 ± 0.1
P-OH benzoic2148.85 ± 0.6
Gallic1750.3 ± 0.8
Caffeine4094.1 ± 0.4
P-Coumaric325.8 ± 0.7
Catechol2501 ± 0.3
Caffeic2711.5 ± 0.5
Cinnamic4457.35 ± 0.3
Chlorogenic11,932.1 ± 0.8
Iso ferulic5592.05 ± 0.9
Benzoic4575.5 ± 0.7
4-amino benzoic acid4228.05 ± 0.6
alpha Coumaric6583.44 ± 0.1
Salicylic4873.23 ± 0.3
Rutin1524.685 ± 0.8
Naringin4424.44 ± 0.3
Apigenin531.975 ± 0.2
Naringenin1097.1415 ± 0.1
Acacetin neo. rutinoside3802.675 ± 0.3
Luteolin 7 glucose5151.4 ± 0.1
Apigenin 6-rhamose 8-glucose5333.25 ± 0.9
Apigenin 6-arabinose 8-glactose1473.28 ± 0.7
Hesperetin588.35 ± 0.8
Kaempferol1277.9 ± 0.3
Quercetin3753.705 ± 0.5
Quercitrin2427.615 ± 0.6
Apigenin-7-0-neohes15,271 ± 0.4
Kaempferol 3-2-p-coumaroylglucose3578.7 ± 0.1
Data are presented mean ± SD.
Table
Table 3. Volatile compounds profile in star anise essential oil.
Table 3. Volatile compounds profile in star anise essential oil.
RtVolatile CompoundsArea%
2.19Furfural0.01 ± 0.001
3.24α-Thujene0.01 ± 0.0002
3.34α-Pinene0.26 ± 0.005
3.63Camphene0.01 ± 0.00
4.12β-Pinene0.03 ± 0.01
4.40Myrcene0.12 ± 0.08
4.67α-Phellandrene0.51 ± 0.007
4.86α-Terpinene0.08 ± 0.004
5.10Limonene2.60 ± 0.1
5.151,8-Cineole0.15 ± 0.02
5.27cis-β-Ocimene0.01 ± 0.001
5.45trans-β-Ocimene0.05 ± 0.002
5.64γ-Terpinene0.11 ± 0.004
5.94cis-Linalool oxide (fur.)0.01 ± 0.009
6.11Terpinolene0.12 ± 0.001
6.25trans-Linalool oxide (fur.)0.05 ± 0.006
6.33para-Cymene0.02 ± 0.001
6.64Linalool0.61 ± 0.002
7.98para-Vinyl anisole0.01 ± 0.007
8.68Terpinen-4-ol0.19 ± 0.003
9.37α-Terpineol2.18 ± 0.2
11.63(Z)-Anethole0.28 ± 0.004
11.85Geraniol0.02 ± 0.001
12.30para-Anisaldehyde0.30 ± 0.002
14.00(E)-Anethole89.24 ± 0.1
17.40α-Copaene0.08 ± 0.002
19.10para-Methyl anisate0.04 ± 0.003
19.40Geranyl acetate0.05 ± 0.002
19.85para-Acetonyl anisole0.12 ± 0.001
20.24cis-α-Bergamotene0.41 ± 0.004
21.78trans-α-Bergamotene0.33 ± 0.02
22.99α-Humulene0.02 ± 0.001
25.98Viridiflorene0.03 ± 0.001
28.40γ-Cadinene0.10 ± 0.02
28.87δ-Cadinene0.03 ± 0.001
29.60Methyl (E)-isoeugenol0.03 ± 0.005
33.66(E)-Nerolidol0.07 ± 0.004
34.08Globulol0.02 ± 0.002
35.85para-Methoxyphenyl-1,2-0.02 ± 0.001
propanediol epimer
37.91τ-Cadinol0.30 ± 0.01
39.24(Z)-Foeniculin0.79 ± 0.02
Rt: Retention time; Data are presented mean ± SD.
Table
Table 4. Primers used in the Gene expression analysis of the goldfish (Carassius auratus).
Table 4. Primers used in the Gene expression analysis of the goldfish (Carassius auratus).
GenesSequence (5′->3′)Accession No.
IL-1βF: GATGCGCTGCTCAGCTTCTAJ249137
R: AGTGGGTGCTACATTAACCATACG
IL-6F-CTGGCCAGACCATATCGCAGDQ861993
R-TTCTGTTCTTGAACTGCTTGACT
TNF-αF: CATTCCTACGGATGGCATTTACTTEU069817
R: CCTCAGGAATGTCAGTCTTGCAT
β-ActinF: GATGCGGAAACTGGAAAGGGAB039726
R: ATGAGGGCAGAGTGGTAGACG
Table
Table 5. The anti-copepodal activity of Illicium verum on L. cyprinacea (Preliminary screening).
Table 5. The anti-copepodal activity of Illicium verum on L. cyprinacea (Preliminary screening).
Tested ConcentrationL. cyprinacea Mortality
M.M. % ± S.E
15 min1 h2 h4 h8 h
25 μg/mL20.9 ± 0.5650 ± 0.5530.0 ± 0.0000 ± 0.0000 ± 0.00
12.5 μg/mL10 ± 0.5640.00 ± 0.9450 ± 0.5000 ± 0.0000 ± 0.00
6.25 μg/mL05 ± 0.3620 ± 0.4840 ± 0.4730 ± 0.7705 ± 0.50
3 μg/mL00 ± 0.0010.0 ± 0.7620.0 ± 0.5925.0 ± 0.5030.0 ± 0.57
2 μg/mL00 ± 0.0000 ± 0.0000 ± 0.0020.5 ± 0.3630.98 ± 1.50
1 μg/mL00 ± 0.0000 ± 0.0000 ± 0.0000 ± 0.0000 ± 0.00
Control treatment with Deltamethrin100 + 0.0000 ± 0.0000 ± 0.0000 ± 0.0000 ± 0.00
Negative Control group with no treatment 00 ± 0.0000 ± 0.0000 ± 0.0000 ± 0.0000 ± 0.00
M.M. % ± S.E = mean mortality ± standard deviation. No mortalities in corresponding groups during the same exposure periods.
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Attia, M.M.; Alzahrani, A.M.; Hanna, M.I.; Salem, H.M.; Abourehab, M.A.S.; El-Saadony, M.T.; Thabit, H. The Biological Activity of Illicium verum (Star Anise) on Lernaea cyprinacea-Infested Carassius auratus (Goldfish): In Vivo Study. Life 2022, 12, 2054. https://doi.org/10.3390/life12122054

AMA Style

Attia MM, Alzahrani AM, Hanna MI, Salem HM, Abourehab MAS, El-Saadony MT, Thabit H. The Biological Activity of Illicium verum (Star Anise) on Lernaea cyprinacea-Infested Carassius auratus (Goldfish): In Vivo Study. Life. 2022; 12(12):2054. https://doi.org/10.3390/life12122054

Chicago/Turabian Style

Attia, Marwa M., Amal M. Alzahrani, Magdy I. Hanna, Heba M. Salem, Mohammed A. S. Abourehab, Mohamed T. El-Saadony, and Hasnaa Thabit. 2022. "The Biological Activity of Illicium verum (Star Anise) on Lernaea cyprinacea-Infested Carassius auratus (Goldfish): In Vivo Study" Life 12, no. 12: 2054. https://doi.org/10.3390/life12122054

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop