OsMATE
(Plasmid
#117093)
-
Purposeprotein expression in yeast
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 117093 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepPICZc
-
Vector typeYeast Expression
Growth in Bacteria
-
Bacterial Resistance(s)Bleocin (Zeocin), 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAtTPT (ORF-HIS)
-
Alt nametr|G9M7W8|G9M7W8_ORYSJ MATE efflux family protein OS=Oryza sativa subsp. japonica GN=OsFRDL4 PE=2 SV=1
- Promoter AOX
-
Tag
/ Fusion Protein
- His (C terminal on insert)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer GACTGGTTCCAATTGACAAGC
- 3′ sequencing primer GCAAATGGCATTCTGACATCC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
An A234T difference in AtTPT compared to the reference sequence is present but does not impact the function of the plasmid.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
OsMATE was a gift from Geoffrey Chang (Addgene plasmid # 117093 ; http://n2t.net/addgene:117093 ; RRID:Addgene_117093)
